Genetics: Microscopic Dysmorphia

[GnomeKid]

I am a student of biology, and as such have to take genetics. 
I knew it was a subject that could possible trigger self loathing [talk of eggs and sperms and X and Y chromosomes ect.] I just didn't expect how much.  Its just one of those unsolvable issues that comes along with being trans, and I know I just need to learn to better separate myself from the material, but its one of the few things that really gets to me for some reason. 

During my first lecture I went from being uncomfortable at her pointing at a boy near the front and saying he had  XY chromosomes.... to amused thinking to myself if she had pointed to me I coulda said "HAH no I don't!"...  to being annoyed that I don't... to being angry at my own DNA [and wanting to quit life] which we all know is just silliness.  Holding a grudge against my genetic blueprint certainly isn't going to change it.

I guess the reason I'm making this thread isn't so much to complain about it [although I seem to have done that well enough] but more because I'm curious how many other trans people find the topic of their genes discomforting.
I've seen people talking about being dysmorphic over health class discussions of ovaries and the like, but never really down to the cellular level.   

thoughts?

[Meepit]

I'm also a Bio student  high five to that! Yeah these topics do get brought up a lot in class. We had many topics on discussions of gender vs. sex in many of my courses actually. In Anthro and Bio, the profs brought up that 1 in 100 children are born with ambiguous genitalia and we actually had a whole lecture or a few on trans people around the world and how it's accepted. The book required for my Anthro course was actually called "Beyond Bodies" which was mandatory reading for the entire class. People generally took it really well. When we had to write a paper on any of the topics discussed during the year, "Gender, sex, and sexuality" was by far the most popular.

In Bio, we have these things called iClickers where if the prof sets up a question on a powerpoint and we can push a button on the iClickers and it'll get recorded (sort of like Who Wants to be a Millionaire for the entire class). During the sex/gender lecture, the prof brought up an article about a female athlete that did really well in a competition but her biological sex was brought into question. Turns out she was intersexed and the question posed to the class was "Would you take back the gold medal/disqualify her?" and the vast majority of the class 85%+ said No. I think there was also a question along the lines of what would you refer to this person as and also the majority said female. After we had all given our answers and seen the results, the prof informed us that she WAS infact disqualified and her medal was taken away and the class became upset.

So, all in all, some lectures can be in our favour (giving us exposure and providing a more understanding outlook on such individuals). Most people are become very interested and understanding of the topics posed and I think this generation is a bit kinder with situations like this.

Biology can be very interesting and show how CLOSE males and females really are as opposed to how different they can be. For example, all males were female for 3 months or so of their life in the womb. Many factors play a part in then changing the female fetus into a male one hence giving many opportunities for this to "mess up". In my final opinion, I see Biology as a way of proving how trans people really aren't that strange after all and it's not a mental disorder. I hope your school turns out to be as open-minded as mine was to all these subjects  good luck this year.

[Asfsd4214]

This issue used to upset me a fair bit.

Then I learned more about intersex conditions, and haven't felt so bad about it since.

[Northern Jane]

For example, all males were female for 3 months or so of their life in the womb.

You might want to check your notes - sexual differentiation begins about 7 weeks.

I have been in the sciences most of my 61 years and my interest in science helped me figure out that I needed estrogen by age 14 (DIY) - I started reading about physiology around age 8. Through my teens I struggled with "what am I" because my scientific side had a clear cut answer but the rest of me said "No, that's not right!" (before anyone ever heard of 'transsexual'). In 1974 I transitioned and had SRS and I didn't think about it any more for decades. I KNEW what I was - a woman, in every way imaginable.

Just recently I went through extensive testing to detect any  Intersex conditions (prompted by unusual hormone levels in my teens) and none were found. When the doctor gave me the results she said "You know this means you are male, right?" and I just laughed. Being XY does not a male make and I am living proof of that! Any doctor discovering I am XY without knowing anything else about me would be totally floored.

[Debra]

I used to be more concerned with the fact that I have XY chromosomes.

Then I read an article about AIS and was like wow, cool.

Wrote a blogpost about it: http://blog.jericanation.com/2010/08/do-chromosomes-define-us.html

[Izumi]

I am a student of biology, and as such have to take genetics. 
I knew it was a subject that could possible trigger self loathing [talk of eggs and sperms and X and Y chromosomes ect.] I just didn't expect how much.  Its just one of those unsolvable issues that comes along with being trans, and I know I just need to learn to better separate myself from the material, but its one of the few things that really gets to me for some reason. 

During my first lecture I went from being uncomfortable at her pointing at a boy near the front and saying he had  XY chromosomes.... to amused thinking to myself if she had pointed to me I coulda said "HAH no I don't!"...  to being annoyed that I don't... to being angry at my own DNA [and wanting to quit life] which we all know is just silliness.  Holding a grudge against my genetic blueprint certainly isn't going to change it.

I guess the reason I'm making this thread isn't so much to complain about it [although I seem to have done that well enough] but more because I'm curious how many other trans people find the topic of their genes discomforting.
I've seen people talking about being dysmorphic over health class discussions of ovaries and the like, but never really down to the cellular level.   

thoughts?

Well, genes arent really the issue to me, anything part of the birth process (including genes) could cause TS and even intersex, including introduction of foreign drugs in the system like DES.  I also wouldnt have minded  being born a guy that wasn't TS, if there was some way I could stay a guy and not transition and be able to function successfully and feel like an average guy then i would have given it a try before transitioning, however there is no such thing.    I have been studying genetics in an effort to find out why this happened to me and if i really do have the mind of girl, i mean it seems i do after all, everything that didnt make sense before in my life makes perfect sense now that i transitioned and everything has really come easy to me with little or no practice, so this must be right? right?

The more i study the more i believe genetics  determine what you are (with some exceptions).  For example the existence of XY AIS females totally immune to testosterone due to a bad receptor on cells (genetic mutation)  the carrier gene being the X chromosome in XY.  To my knowledge no AIS women have ever wanted to transition to men (at least i couldnt find any information and its hard to find anything) , they are in fact pure women(except for reproduction), since testosterone doesnt effect them they make ideal control subjects to the effects of androgens effects on the brain.  So the more i look into it, the more i believe the reason your TS is a just a section of DNA wasn't coded the same as everyone else and has a variation that a minority of 1/20000 share (obviously not the norm).  I believe TS to be a milder form of intersex, where certain stem cells are affected more then others during development.   

[milktea]

well i was very uneasy when my tutor was talking about intersex conditions...xxy, xyy, xxxy...

izumi: i think social conditioning takes a big part as well. if you're brought up as a guy no matter what's between your legs, provided you're not a ts who has got a strong desire to be the opposite sex that was determinable at birth, you'll readily grow some guy habits that can't be shaken off, ever...

[Izumi]

well i was very uneasy when my tutor was talking about intersex conditions...xxy, xyy, xxxy...

izumi: i think social conditioning takes a big part as well. if you're brought up as a guy no matter what's between your legs, provided you're not a ts who has got a strong desire to be the opposite sex that was determinable at birth, you'll readily grow some guy habits that can't be shaken off, ever...

I grew up as a guy, typically environment.  2 parents, the ideal setting, happy childhood, i thought i was a guy for a long time till i looked back, i always knew something was not right but i thought it would just go away so i kept up the guy act thinking that is what was expected.

When i went full time, i dropped it 100%, just stopped acting like a guy, never practiced being a girl, never did anything but let stuff i held back go.  My friends couldnt believe it, there was not a thing guy about me overnight.  I spoke like a woman, my mannerisms were like one unconsciously.  I have even been called, and i am not kidding because it surprised the hell out of me a "True Woman" by someone that didnt know I was TS. 

Not a single guy trait.  I have some guy interests, but so do a lot of cis women.  While maybe its possible you keep some guy traits, its not 100% always the case that you will.  I dont believe you can socially be turned into a TS either.  I knew when i was 5, and the whole world told me no.  I only say 5 because i cant remember before that.   The only ones who socially change do it for outside reasons... money maybe being a big one.

[Rayalisse]

Since I don't really believe in a god (cuz God don't make mistakes... but did in my case?), I wind up shaking my fist at my chromosomes for putting me in the wrong body!! 

But, I've always been female.  Just in a male body. 

If a cis female got to be put in a male body for a long time (like Freaky Friday or something), what would they do?  I sometimes imagine that's me.  I got Freaky Friday'ed into this body. Just waiting for the spell to wear off or for me to learn my lesson so that I can switch back...

Cheers!
Rayalisse

[Meepit]

You might want to check your notes - sexual differentiation begins about 7 weeks.

I've heard this as well, but from my sources it varied from 1-3 months so I guess it MAY vary depending on certain circumstances.I think 3 months was from the most recent source I read so I just readily threw that number out there  . But I can second your timeline as well.

[Debra]

When i went full time, i dropped it 100%, just stopped acting like a guy, never practiced being a girl, never did anything but let stuff i held back go.  My friends couldnt believe it, there was not a thing guy about me overnight.  I spoke like a woman, my mannerisms were like one unconsciously.  I have even been called, and i am not kidding because it surprised the hell out of me a "True Woman" by someone that didnt know I was TS. 

Yeah I can kind of relate. My mannerisms just kind of happened, it's quite weird. The one thing that I had to kind of jump into was walking. It's easier in heels but the different kind of walk, head up, straight back, letting hips lead....that has taken some conscious effort...esp when not in heels.

[Silver]

It bothered me in the past, but I don't care anymore

What really gets to me is the "well, yeah, but you're not really male." Can't see my chromosomes anyway, if I looked male and all I wouldn't care if I was an XX male. So I've reasoned out of being bothered by it.

[Karla]

I avoid biology like the plague. It's a shame since it's one of the subject I most have an aptitude for.

[placeholdername]

I think people make a bigger deal of genetics than they need to.  Humans have 46 chromosomes.  Genetic gender is determined by *one* of those, and even then, it doesn't always work right.  The Y chromosome is even smaller than most of the other chromosomes anyway...

[spacial]

Since I don't really believe in a god (cuz God don't make mistakes... but did in my case?),

Cheers!
Rayalisse

Not to be off topic, but perhaps he didn't make any mistake at all.

We may have a slightly longer road to travel, but we have experiences that few others can ever have.

Experience = Wisdom = better humans.

[Rayalisse]

Not to be off topic, but perhaps he didn't make any mistake at all.

We may have a slightly longer road to travel, but we have experiences that few others can ever have.

Experience = Wisdom = better humans.

I don't want to get into a debate about theology on this thread, so for now lets agree to disagree on the god part... like you said, its probably off topic and kinda out of context for the point of my post.

But I do agree that regardless of one's theology or lack thereof, there are experiences along this road that are unique and allow me and those I share the path with to hopefully gain wisdom.  Not everybody gets to be a genetically male woman (or whatever applies to y'all)

At the very least we gain a different perspective, and hopefully if we've been paying attention along the way, we may learn something profound.   Whenever I find that insight, I'll try to share it if I can.

[pebbles]

Yes I know what you mean I've used my biology abilities for the same purpose. I went pretty extreme

Specifically I read about the Androgen receptor and the gene the relates to it. I was thinking "Maybe I'm asking too much if I beg a deity to transform my corrupted body."

Right at the start of the Androgen receptor gene there is a sequence a chain of amino acids that dictates the binding function of the AR to it's conjugate.

This sequence is called the N-terminal domain it goes.
CAGCAGCAGCAGCAGCAGCAG Anywhere between 170-360 times Transsexuals are believed to have Excess of these repeats in excess of 360+ times resulting in a bad testosterone signal I'd be asking too much to remove all my extra repeats at the moment of my conception but if I could go back to the moment I was conceived and I would give everything to just modify one base of these hundreds of repeats.

CAGCAGCAGCAGTAGCAG Instead of a chain of glutamine residues it would create a "Stop" codon that tells the ribosome building the protein to disconnect and cease construction. This would abolish all function of the androgen receptor generating C-AIS. Tiny tiny mutation altering a few atoms so few you could count them on a hand. at a specific moment in time. it was beyond my power to change them but I pleaded for any entity with that power to change that Of course it doesn't happen. :/ It's not healthy to dwell inwardly.

[Meepit]

Ugh I just HAD to come back to this thread after what happened in class today. In my personality psych class we had an anonymous polling of the sex of everyone in the class (along with other random questions to see if there was a correlation). Of course the only two options put up by the lecturer were: A = female and B= male. I didn't know what to put because I tend to get paranoid that people watch what I do to see what sex I am (like which bathroom I go to etc.). However, whilst the polling was happening, some kids put C, D, and E as a blank or "other". Perhaps they were just being funny, but I decided to go for E as well. Overall in the class of about 300, 4 of us chose "other", much to the professor's teasing (he said stuff like "oh, I'm sure it's hard to choose...." sarcastically). So what I got from this was, maybe there were other people in the class that were "other" or uncomfortable with answering which made me feel better  BUT, I realized that perhaps my professor isn't too familiar or kind with gender-variance which surprises me because he seems to be the first prof. I've come across that is like that (especially in a scientific field that studies people). Oh well, perhaps I'm just being too sensitive  .

[pebbles]

The more i study the more i believe genetics  determine what you are (with some exceptions).  For example the existence of XY AIS females totally immune to testosterone due to a bad receptor on cells (genetic mutation)  the carrier gene being the X chromosome in XY.  To my knowledge no AIS women have ever wanted to transition to men (at least i couldnt find any information and its hard to find anything) , they are in fact pure women(except for reproduction), since testosterone doesnt effect them they make ideal control subjects to the effects of androgens effects on the brain.  So the more i look into it, the more i believe the reason your TS is a just a section of DNA wasn't coded the same as everyone else and has a variation that a minority of 1/20000 share (obviously not the norm).  I believe TS to be a milder form of intersex, where certain stem cells are affected more then others during development.

Not the case Izumi
http://www.springerlink.com/content/m511462m53023j37/
The case of a 46XY CAIS (Female phenotype) Transman.

This one individual doesn't disprove all the other evidence however it certainly seems to be the case that T determines Gender as Females with cases of Adrenal Hyperplasia have increased incidents of GID.

And cross gender behavior was induced into female rhesus monkeys by exposing Fetuses to T (Specifically during first trimester) later exposure resulted in no deviation in gender behavior but did result in Ambiguous genitals.